BSU33000

BSU_33000

1374

1377

BSU33000

BSU_33000

3,384,070 → 3,385,446

3,384,070 3,385,446

peptidase S1B family (according to Swiss-Prot)

Peptidase S1C family (with [[protein|HtrA]] and [[protein|HtrC]], according to UniProt)

cell membrane (according to Swiss-Prot)

randomly distributed in foci throughout the cell surface [Pubmed|22307758]

cell membrane (according to UniProt)

randomly distributed in foci throughout the cell surface [Pubmed|22307758]

MGNA-B207 (yvtA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1206 NBRP B. subtilis, Japan]

MGNA-B207 (yvtA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1206 NBRP B. subtilis, Japan]

BKE33000 ([[gene|htrB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTACACTCCTTTA, downstream forward: _UP4_TAAGAAAAAACAAAAAGCTG

BKK33000 ([[gene|htrB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTACACTCCTTTA, downstream forward: _UP4_TAAGAAAAAACAAAAAGCTG

22688815, 21326199, 25212246

22688815, 21326199, 25212246, 31001739

17600057, 22307758, 12270824, 22092710, 24362423, 24115457, 11133960, 21532594

17600057, 22307758, 12270824, 22092710, 24362423, 24115457, 11133960, 21532594, 32111210

Acts on substrates that are at least partially unfolded. The cleavage site P1 residue is normally between a pair of hydrophobic residues, such as Val-|-Val (according to UniProt)

[[this]]

cytoplasmic domain (aa 1 - 71) (according to UniProt)

transmembrane helix (aa 72 - 92) (according to UniProt)

extracellular domain (aa 93 - 458) (according to UniProt)

[SW|PDZ domain] (aa 350- 449) (according to UniProt)